 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circANRIL | |||
| Gene | ANRIL | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Atherosclerosis | ICD-10 | Atherosclerosis (I70) |
| DBLink | Link to database | PMID | 27539542 |
| Experimental Method | |||
| Sample Type | Peripheral Blood Mononuclear Cells (PBMCs), Tissues and Cell lines | Comparison | Human endarterectomy specimens (n=218) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward GCTGGGATTACAGGTGTGAGACACC ReverseGAATCAGAATGAGGCTTATTCTTCTCATC | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Holdt, LM, Stahringer, A, Sass, K, Pichler, G, Kulak, NA, Wilfert, W, Kohlmaier, A, Herbst, A, Northoff, BH, Nicolaou, A, Gabel, G, Beutner, F, Scholz, M, Thiery, J, Musunuru, K, Krohn, K, Mann, M, Teupser, D (2016). Circular non-coding RNA ANRIL modulates ribosomal RNA maturation and atherosclerosis in humans. Nat Commun, 7:12429. | |||